View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11034_high_2 (Length: 374)
Name: NF11034_high_2
Description: NF11034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11034_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 365
Target Start/End: Original strand, 40174751 - 40175119
Alignment:
| Q |
1 |
tagagaaagtggacttcac-tatctaagtatatctatgtatagagtatagatatgattcatgataaaaa---tcatagttcaatacatgtgagagttgag |
96 |
Q |
| |
|
|||||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
40174751 |
tagagaaagtggacttaacctatctaagaatatctatgtatagagtatagatatgattcatgataaaaaaaatcacagttcaa-acatgtgagagttgag |
40174849 |
T |
 |
| Q |
97 |
ggtgggaa-ctgttcagttaacaatnnnnnnnnggttttgattgttgcgttattaatttggattctgtaggattcgtaatgccggtaac-aacttcatgt |
194 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||| |||||| ||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
40174850 |
ggtgggaaactgttcagttaacaa-aaaaaaaaggttttgactgttgcattattaatttggattttgtaggattcgtaatgccggtaactaacttcatgt |
40174948 |
T |
 |
| Q |
195 |
aattaaggtcgcaatgcatgcaaattagtggggtatcaggggctagattgaagggtgtaaaggggttgtccatttagaattctagtcatctattagacta |
294 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
40174949 |
aattaaggttgcaatgcatgcaaattagtggggtatcagggactagattgaagggtgtaaaggggttgtccatttagaattgcagtcatctattaggcta |
40175048 |
T |
 |
| Q |
295 |
ttaatttgcacacgccatctatttatggctacatatggcttgaatatctggctcttattgcatatctctgc |
365 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40175049 |
ttaatttgcacacgcaatctatttatggctacatatggcttgaatatctggctcttattgcatatttctgc |
40175119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University