View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11035_high_10 (Length: 318)
Name: NF11035_high_10
Description: NF11035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11035_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 18 - 291
Target Start/End: Complemental strand, 43953869 - 43953596
Alignment:
| Q |
18 |
acaagataccgaaagaaatcattttgttttgcattttcccgggagaaatgtagatggtgatactagnnnnnnntgaagtctacgaggcagctctcgaagc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43953869 |
acaagataccgaaagaaatcattttgttttgcattttcccgggagaaatgtagatggtgatactagaaaaaaatgaagtctacgaggcagctctcgaagc |
43953770 |
T |
 |
| Q |
118 |
acaaggaatctcacatcttatgtcttctgaagttgtcaaggcatttttggattctaacaaactctctagaggttagatcgagataaggcatttcagcacc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953769 |
acaaggaatctcacatcttatgtcttctgaagttgtcaaggcatttttggattctaacaaactctctagaggttagatcgagataaggcatttcagcacc |
43953670 |
T |
 |
| Q |
218 |
attgaaaaatgcttttgtatttaatctgtttttctgttaaactttagaaaataccttatatgatgattttatta |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953669 |
attgaaaaatgcttttgtatttaatctgtttttctgttaaactttagaaaataccttatatgatgattttatta |
43953596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University