View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11035_high_11 (Length: 285)
Name: NF11035_high_11
Description: NF11035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11035_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 40149791 - 40150052
Alignment:
| Q |
1 |
tatgagacacttctccatcctagaaccccaccttaaaataaaccagaatctttgtcctgatttagtcttccagttgatcacagcaaatcacaataacctt |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40149791 |
tatgagacacttct---tcctagaaccccaccttaaaataaaccagaatctttgtcctgatttagtcttccagttgatcacagcaaatcacaataacctt |
40149887 |
T |
 |
| Q |
101 |
tgaccattacattgttgtacgtacgaatgacaatattatctagttatgtcataaagattgctcttacatggtcttgctgtcctgcaccacatcaacaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40149888 |
tgaccattacattgttgtacgtacgaatgacaatattatctagttatgtcataaagattg--cttacatggtcttgctgtcctgcaccacatcaacaact |
40149985 |
T |
 |
| Q |
201 |
actgtggaatttgacaggtcagggaaatcaaaacccattcctttaccatagtaggccagtgcattgt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40149986 |
actgtggaatttgacaggtcagggaaataaaaacccattcctttaccatagtaggccagtgcattgt |
40150052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University