View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11035_high_16 (Length: 224)
Name: NF11035_high_16
Description: NF11035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11035_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 8 - 211
Target Start/End: Complemental strand, 7336391 - 7336188
Alignment:
| Q |
8 |
gagagatgaatgaagaagaattaatgagagaaacaatggaagaaagtagtattaaaaagggaaattagttgagaggtagttatagagatccttgggaatt |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7336391 |
gagatatgaatgaagaagaattaatgagagaaacaatggaagaaagtagtattaaaaagggaaattagttgagaggtagttatagagatccttgggaatt |
7336292 |
T |
 |
| Q |
108 |
gacggattatttaatgttgtacaatctttttatctctctttctttaatcattttccactagctagctagtttccttggttatactttttgggcatgtgat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
7336291 |
gacggattatttaatgttgtacaatctttttatctctctttctttaatcattttccactagctagctagcttccttagttatactttttgggcatgtgat |
7336192 |
T |
 |
| Q |
208 |
tttt |
211 |
Q |
| |
|
|||| |
|
|
| T |
7336191 |
tttt |
7336188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University