View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11036_high_55 (Length: 281)
Name: NF11036_high_55
Description: NF11036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11036_high_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 269
Target Start/End: Complemental strand, 47349424 - 47349173
Alignment:
| Q |
18 |
ctatcgcatgctgaaattcggttgaattttgatgagagaaagtttctctgtcagtgtagtcttttgattacagatttttcacggttcttgagtttgatta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47349424 |
ctatcgcatgctgaaattcggttgaattttgatgagagaaagtttctctgtcagtgtagtcttttgattacagattttccacggttcttgagtttgatta |
47349325 |
T |
 |
| Q |
118 |
gctnnnnnnnttatatgaaattcgacttggatctgaatcagttcgannnnnnngtttattgttttgaactgatttttgtgtaaattgaattgacctagaa |
217 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47349324 |
actaaaaaaattatatgaaattcgacttggatctgaatcagttcgatttttttgtttattgttttgaactgatttttgtgtaaattgaattgacctagaa |
47349225 |
T |
 |
| Q |
218 |
agttatgtagaaagatattctggcattttatttgttcattattataggttca |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
47349224 |
agttatgtagaaagatattctggcattttatctgttcattattatagcttca |
47349173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University