View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11036_high_56 (Length: 280)
Name: NF11036_high_56
Description: NF11036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11036_high_56 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 26 - 80
Target Start/End: Complemental strand, 11754836 - 11754782
Alignment:
| Q |
26 |
gatcttcattggatccacaaatcctgaaaataaaagtaaaagttcattagcatgt |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
11754836 |
gatcttcattggatccacaaatcctgaaaataaaagtcaaatttcattagcatgt |
11754782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 252 - 280
Target Start/End: Complemental strand, 18915115 - 18915087
Alignment:
| Q |
252 |
atgtccccgtgagtttagctcagttggta |
280 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18915115 |
atgtccccgtgagtttagctcagttggta |
18915087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University