View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11036_high_58 (Length: 270)
Name: NF11036_high_58
Description: NF11036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11036_high_58 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 33 - 253
Target Start/End: Original strand, 47443612 - 47443832
Alignment:
| Q |
33 |
gagataaaatgcttaatgttatgaaccaatctatataaacaccatacccaactgggtccattcccagagggaccatcccatccaacatgagccacatgct |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47443612 |
gagataaaatgcttaatgttatgaaccaatctatataaacaccatacccaactgggtccattcccagagggaccatcccatccaacatgagccacatgct |
47443711 |
T |
|
| Q |
133 |
taacatccgtcgggtacccaatttccatctctctttccttcacaactggaaaaagacccatttcatattttagcccaaacaataacaaaacacagaaata |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47443712 |
taacatccgtcgggtacccaatttccatctctctttccttcacaactggaaaaagacccatttcatattttagcccaaacaataacaaaacacagaaata |
47443811 |
T |
|
| Q |
233 |
ttaattggtaaagttacaaag |
253 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
47443812 |
ttaattggtaaagttacaaag |
47443832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 75 - 179
Target Start/End: Original strand, 3238316 - 3238420
Alignment:
| Q |
75 |
catacccaactgggtccattcccagagggaccatcccatccaacatgagccacatgcttaacatccgtcgggtacccaatttccatctctctttccttca |
174 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||| |||||||||||||||||||| || || | ||||||||| ||||| || ||||||| |
|
|
| T |
3238316 |
catacccaactgggtccatttccattgggaccatcccatccaatgtgagccacatgcttaacatctgttggatgcccaatttctatctccctctccttca |
3238415 |
T |
|
| Q |
175 |
caact |
179 |
Q |
| |
|
||||| |
|
|
| T |
3238416 |
caact |
3238420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University