View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11036_high_76 (Length: 243)
Name: NF11036_high_76
Description: NF11036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11036_high_76 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 147 - 228
Target Start/End: Original strand, 39052055 - 39052137
Alignment:
| Q |
147 |
cggacctaagctacttaccacatata-gaccaagttccttactacctaacctcccctggaggcctggacaactagttatatat |
228 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39052055 |
cggacctaagctacttaccacatacaagaccaagttccttactacctaacctcccctggaggcctggacaactagttatatat |
39052137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 39051901 - 39051936
Alignment:
| Q |
1 |
taactttcatattgtatccatcacaattattcacta |
36 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39051901 |
taactttcatatcgtatccatcacaattattcacta |
39051936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University