View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11036_high_76 (Length: 243)

Name: NF11036_high_76
Description: NF11036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11036_high_76
NF11036_high_76
[»] chr4 (2 HSPs)
chr4 (147-228)||(39052055-39052137)
chr4 (1-36)||(39051901-39051936)


Alignment Details
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 147 - 228
Target Start/End: Original strand, 39052055 - 39052137
Alignment:
147 cggacctaagctacttaccacatata-gaccaagttccttactacctaacctcccctggaggcctggacaactagttatatat 228  Q
    |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39052055 cggacctaagctacttaccacatacaagaccaagttccttactacctaacctcccctggaggcctggacaactagttatatat 39052137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 39051901 - 39051936
Alignment:
1 taactttcatattgtatccatcacaattattcacta 36  Q
    |||||||||||| |||||||||||||||||||||||    
39051901 taactttcatatcgtatccatcacaattattcacta 39051936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University