View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11036_high_97 (Length: 202)
Name: NF11036_high_97
Description: NF11036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11036_high_97 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 14 - 185
Target Start/End: Complemental strand, 587272 - 587101
Alignment:
| Q |
14 |
cacagacacagtcaagttcttctctactaaaggaatttatttctttcacaaaactgagaggcacaaaattgtatattaatcttcctcccaaatttagcac |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
587272 |
cacaaacacagtcaagttcttctctactaaaggaatttatttctttcacaaaactgagaggcacaaaattgtatattaatcttcctcccaaatttagcac |
587173 |
T |
 |
| Q |
114 |
aaacactttgatggagcagtaacacgaaccgaacttgctagctatattgaatggcaacttgccacttaattg |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
587172 |
aaacactttgatggagcagtaacacgaaccgaacttgctagctatattgaatggcaacttgccacttaattg |
587101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University