View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11036_low_43 (Length: 347)
Name: NF11036_low_43
Description: NF11036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11036_low_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 17 - 331
Target Start/End: Original strand, 38618723 - 38619037
Alignment:
| Q |
17 |
gaaaatggttccctcaggagtgacctaagccaagtgatacaagaatgacgagcgacctatcccgaatgttgcttggtggatgtcctatttttgaggctta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
38618723 |
gaaaatggttccctcaggagtgacctaagccaagtgatacaagaatgatgagcgacctatcccgaacgttgcttggtggatgtcctatttttgagggtta |
38618822 |
T |
|
| Q |
117 |
tagattgagtgagacaaggatggtgctaattgtgtgtaatgtatatatagatgtgcatcatattcatatcattgtgaatgtctatctctaagggggaaaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38618823 |
tagattgagtgagacaaggatggtgctaattgtgtgttatgtatatatagatgtgcatcatattcatatcattgtgaatgtctatctctaagggggaaaa |
38618922 |
T |
|
| Q |
217 |
caccgttgaattaggaaggggaagactgctatgggagggctaagaaaatcttgattctggcttgggggagggctgtagaatggcaacatatgacgtcata |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38618923 |
caccgttgaattaggaaggggaagactgctatgggagggctaagaaaatcttgattctggcttgggggagggctgtagaatggcaacacatgacgtcata |
38619022 |
T |
|
| Q |
317 |
ccctaataatgaacc |
331 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
38619023 |
ccctaataatgaacc |
38619037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University