View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11036_low_51 (Length: 305)
Name: NF11036_low_51
Description: NF11036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11036_low_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 6 - 245
Target Start/End: Original strand, 39108446 - 39108685
Alignment:
| Q |
6 |
gagagatgaaaccaaaacctcaaatagtgttctgttttgatattttcatgattcaaccttgaatcttcttcactcacatcaccattttcaaccnnnnnnn |
105 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39108446 |
gagagaagaaaccaaaacctcaaatagtgttctgttttgatattttcatgattcaaccttgaatcttcttcaatcacatcaccattttcaaccaaaaaac |
39108545 |
T |
 |
| Q |
106 |
nnnnntggctgtcacaacttcctttctcaattcaacagagaaaaaacaacactggtggctcacaaaccgtaaagtaaacctctaaatatttcaccttaaa |
205 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39108546 |
aaaaatggctgtcacaacttcctttctgaattcaacagagaaaaaacaacactggtggctcacaaaccgtaaggtaaacctctaaatatttcaccttaaa |
39108645 |
T |
 |
| Q |
206 |
ttcttgttttgttttttcattctcaaaacatgtctgaata |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39108646 |
ttcttgttttgttttttcattctcaaaacatgtctgaata |
39108685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University