View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11036_low_55 (Length: 293)
Name: NF11036_low_55
Description: NF11036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11036_low_55 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 51150977 - 51151122
Alignment:
| Q |
1 |
atgaaatttagataagtacaaacaaaacattttctacaaataatacaacattagcnnnnnnnnnnnnatataaaagataaaatacaatattactctcttt |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51150977 |
atgaaatttagataagtacaatcaaaacattttctacaaataatacaacattagctttttgttttttatataaaagataaaatacaatattactctcttt |
51151076 |
T |
|
| Q |
101 |
ggttctataaaagaaagttgaatatttaactcaaattttgaacaaa |
146 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
51151077 |
ggttctataagagaaagttgaatatttaactcaaatttttaacaaa |
51151122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 145 - 237
Target Start/End: Original strand, 51151144 - 51151236
Alignment:
| Q |
145 |
aattttcttttataatacaaaatcagagagtattttgaatttttaatcacttcaaacaattgcttttatcaagaatgcctcaccatggccata |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51151144 |
aattttcttttataatacaaaatcagagagtatattgaatttttaatcacttcaaacaagtgcttttatcaagaatgcctcaccatggccata |
51151236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University