View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11036_low_62 (Length: 265)
Name: NF11036_low_62
Description: NF11036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11036_low_62 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 10 - 248
Target Start/End: Complemental strand, 1160568 - 1160330
Alignment:
| Q |
10 |
agatgaagctagaagcatgcaaagcaatgaacaagctcaaggctttaatggtacaatttatttaccttttcaaacaagcacaaatttcaatattgtttca |
109 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1160568 |
agatgaagctagaagcattcaaagcaatgaacaagctcaaggctttaatggtacaatttatttaccttttcaaacaagcacaaatttcaatattgtttca |
1160469 |
T |
 |
| Q |
110 |
cacacttttggtttgataacttgttttattcaaattatagggaacttagatggaaatggaaatattgaggcatctacaaggttgaaccacagagatgggt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1160468 |
cacacttttggtttgataacttgttttattcaaattatagggaacttagatggaaatggaaatattgaggcatctacaaggttgaaccacaaagatgggt |
1160369 |
T |
 |
| Q |
210 |
ttgaggaaagtcaaaatgcacacaaacatgaactatctg |
248 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1160368 |
ttgtggaaagtcaaaatgcacacaaacatgaactatctg |
1160330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University