View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11036_low_63 (Length: 257)
Name: NF11036_low_63
Description: NF11036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11036_low_63 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 13447591 - 13447348
Alignment:
| Q |
1 |
gattagcccctaatttgtttcattcgctatacataccaagtttggttcgaatgcatttctttcatgtctggttttcaatcatctacaatctgtgcaccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13447591 |
gattagcccctaatttgtttcattcgctatacataccaagtttggttcgaatgcatttctttcatgtctggttttcaatcatctacaatctgtgcaccaa |
13447492 |
T |
|
| Q |
101 |
cactgttgtatttttt-cgatggatctcttgtcgtgttggtgatccattggtgtcgtcgttgaggcgtctgtcggtggtgggtcaggacatgtcggtgga |
199 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13447491 |
cactgttgtatttttttcgatggatctcttgtcgtgttgatgatccattggtgtcgtcgttgaggcgtctgtcggtggtgggtcaggacatgtcggtgga |
13447392 |
T |
|
| Q |
200 |
atttgcttcgctcattgcagataggactgcaggggtgtggtaat |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13447391 |
atttgcttcgctcattgcagataggactgcaggggtgtggtaat |
13447348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University