View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11036_low_66 (Length: 254)
Name: NF11036_low_66
Description: NF11036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11036_low_66 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 35435526 - 35435765
Alignment:
| Q |
1 |
tccatcaaatatgcatcttgtttttcctaatcttagatcatttttggtgggagagaaccacataagcggaactttgccgttgtcaatatcaaatatcacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35435526 |
tccatcaaatatgcatcttgtttttcctaatcttagatcatttttggtgggagagaaccacataagcggaactttgccgttgtcaatatcaaatatcacc |
35435625 |
T |
 |
| Q |
101 |
ggtctgaaatggttcgatatatccattaacaattttcatgggccagtacctccaaccttggggaacttgaacaaacttgagaggtttgccattggttata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||| |
|
|
| T |
35435626 |
ggtctgaaatggttcgatatatccattaacaattttcatgggccagtacctccaaccttggggcacttgaacaaacttaggaggtttgacattggttata |
35435725 |
T |
 |
| Q |
201 |
atggttttgggagtggaagagctcatgatttggatttcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35435726 |
atggttttgggagtggaagagctcatgatttggatttcat |
35435765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 35422181 - 35422270
Alignment:
| Q |
1 |
tccatcaaatatgcatcttgtttttcctaatcttagatcatttttggtgggagagaaccacataagcggaactttgccgttgtcaatatc |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |||||||| |
|
|
| T |
35422181 |
tccatcaaatatgcatcttgtttttcctaatcttagatcatttttggtgggagggaaccacataagcggaacttttccgtgttcaatatc |
35422270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 35753330 - 35753422
Alignment:
| Q |
1 |
tccatcaaatatgcatcttgtttttcctaatcttagatcatttttggtgggagagaaccacataagcggaactttgccgttgtcaatatcaaa |
93 |
Q |
| |
|
||||||||||||| ||||||||||||| | ||||| | ||| ||||| |||| |||| | ||||||||||||| |||| ||||||||||| |
|
|
| T |
35753330 |
tccatcaaatatgaatcttgtttttcccagtcttaaagaattcttggtaggagggaacaatttaagcggaacttttccgtcttcaatatcaaa |
35753422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University