View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11036_low_71 (Length: 248)
Name: NF11036_low_71
Description: NF11036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11036_low_71 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 10 - 248
Target Start/End: Original strand, 3934140 - 3934379
Alignment:
| Q |
10 |
atgaatatgaatctaggtgatttaattacctaaaatatttaaacaaatctcctgataataatgcatcgggcctaatcaattttgtagagaagtaaaggat |
109 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3934140 |
atgaatatgaatc-aggtgatttaattacctaaaatatttaaacaaatctcctgataataatgcatcgggcctaatcaattttgtagagaagtaaaggat |
3934238 |
T |
 |
| Q |
110 |
cctctcacataggaaaaagaccaca-ctggaatagtgatattccatcaatgatttatatattaaacaatataaggatgagtggctaaac-aaaattagtt |
207 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3934239 |
cctctcacataggaaaaagaccacacctggaatagtgatattccatcaatgatttatatattaaacaatataaggatgagtggctaaacaaaaattagtt |
3934338 |
T |
 |
| Q |
208 |
atgattatattatttattttacaagaatgaaagtgatattt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3934339 |
atgattatattatttattttacaagaatgaaagtgatattt |
3934379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University