View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11036_low_78 (Length: 243)
Name: NF11036_low_78
Description: NF11036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11036_low_78 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 233; Significance: 1e-129; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 1490114 - 1490346
Alignment:
| Q |
1 |
tcactgatgacaaagaaggactcaattctggttagcattatgccaaattgatacaccctcttattacgtctatgcagtaactaaacaaatatatttaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1490114 |
tcactgatgacaaagaaggactcaattctggttagcattatgccaaattgatacaccctcttattacgtctatgcagtaactaaacaaatatatttaatt |
1490213 |
T |
|
| Q |
101 |
aagaatatgcagataatatctcaagtttgtgattgcttgaacttatgactaatttttgtcatgttgccagaacttgagaagcacattcctgatctcaatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1490214 |
aagaatatgcagataatatctcaagtttgtgattgcttgaacttatgactaatttttgtcatgttgccagaacttgagaagcacattcctgatctcaatg |
1490313 |
T |
|
| Q |
201 |
tcctgatatccacaccatttcaccctgcctatg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1490314 |
tcctgatatccacaccatttcaccctgcctatg |
1490346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 162 - 233
Target Start/End: Original strand, 1495007 - 1495078
Alignment:
| Q |
162 |
tgttgccagaacttgagaagcacattcctgatctcaatgtcctgatatccacaccatttcaccctgcctatg |
233 |
Q |
| |
|
|||| |||||||| |||||||||||||| ||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1495007 |
tgttaccagaactcgagaagcacattcccgatctgcatgtcctgatatctacaccatttcaccctgcctatg |
1495078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 1494891 - 1494952
Alignment:
| Q |
1 |
tcactgatgacaaagaaggactcaattctggttagcattatgccaaattgatacaccctctt |
62 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||| || |||||| || ||||||||| |
|
|
| T |
1494891 |
tcactgatgacaaagaaggacctgattctggttagaattttgacaaattaatccaccctctt |
1494952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University