View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11036_low_89 (Length: 229)

Name: NF11036_low_89
Description: NF11036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11036_low_89
NF11036_low_89
[»] chr4 (1 HSPs)
chr4 (7-229)||(46301401-46301632)
[»] chr7 (1 HSPs)
chr7 (65-130)||(24508690-24508754)


Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 46301632 - 46301401
Alignment:
7 gtaacaacctcttttgaaaagggaaatgataccataatatgaaatgag---------tttaatttgcattgattatgaatgaagagtagatttagtattt 97  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||| ||||||||||     
46301632 gtaacaacctcttttgaaaagggaaatgataccataatatgaaatgagagaaatgagtttaatttgcattgattatgaatgaagagtacatttagtattc 46301533  T
98 atatacaaggctattgtactactaatatgtattaaacttcactaaaatgtactacactatgatgatttgtactactagctatactaactaactcttattc 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46301532 atatacaaggctattgtactactaatatgtattaaacttcactaaaatgtactacactatgatgatttgtactactagctatactaactaactcttattc 46301433  T
198 aagtatttataacagaacaccctccctaaaaa 229  Q
    ||||||||||||| ||||| ||||||||||||    
46301432 aagtatttataactgaacaacctccctaaaaa 46301401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 65 - 130
Target Start/End: Complemental strand, 24508754 - 24508690
Alignment:
65 attgattatgaatgaagagtagatttagtatttatatacaaggctattgtactactaatatgtatt 130  Q
    ||||||| ||||||| ||||  ||||| ||||||||||||||||||||||||||||||||||||||    
24508754 attgattgtgaatga-gagtgcatttaatatttatatacaaggctattgtactactaatatgtatt 24508690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University