View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11036_low_92 (Length: 220)

Name: NF11036_low_92
Description: NF11036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11036_low_92
NF11036_low_92
[»] chr1 (1 HSPs)
chr1 (17-204)||(46308695-46308882)


Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 46308882 - 46308695
Alignment:
17 atgaatcacaatgggaagatgctgagtcaaagagagctcttggatatgacatccccaaaacgaacaaaccattgagcattagacaaattgttatcctgct 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
46308882 atgaatcacaatgggaagatgctgagtcaaagagagctcttggatatgacatccccaaaacgaacaaaccattgagcattagacaagttgttatcctgct 46308783  T
117 gaggttgtagtccatcgaattttctgtggtgctgtcccttctcggcaacaaaaggtgcatagtcaaaactcttggcagcagctgcaac 204  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46308782 gaggttgtagtccatccaattttctgtggtgctgtcccttctcggcaacaaaaggtgcatagtcaaaactcttggcagcagctgcaac 46308695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University