View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11036_low_92 (Length: 220)
Name: NF11036_low_92
Description: NF11036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11036_low_92 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 46308882 - 46308695
Alignment:
| Q |
17 |
atgaatcacaatgggaagatgctgagtcaaagagagctcttggatatgacatccccaaaacgaacaaaccattgagcattagacaaattgttatcctgct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46308882 |
atgaatcacaatgggaagatgctgagtcaaagagagctcttggatatgacatccccaaaacgaacaaaccattgagcattagacaagttgttatcctgct |
46308783 |
T |
 |
| Q |
117 |
gaggttgtagtccatcgaattttctgtggtgctgtcccttctcggcaacaaaaggtgcatagtcaaaactcttggcagcagctgcaac |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46308782 |
gaggttgtagtccatccaattttctgtggtgctgtcccttctcggcaacaaaaggtgcatagtcaaaactcttggcagcagctgcaac |
46308695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University