View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11037_high_5 (Length: 220)
Name: NF11037_high_5
Description: NF11037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11037_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 75 - 204
Target Start/End: Complemental strand, 781122 - 780993
Alignment:
| Q |
75 |
atgtcctcaaaggatcacaaatccacactttccctttggtatgtactttaagatgatcactactatcccatttttattattcacattgatattgagtatg |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
781122 |
atgtcctcaaaggatcacaaatccacactttccctttggtatgtactttaagatgatcattactatcccatttttattattcacattgatattgagtatg |
781023 |
T |
|
| Q |
175 |
gacatatataatttctatatgcacattatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
781022 |
gacatatataatttctatatgcacattatt |
780993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 781161 - 781120
Alignment:
| Q |
1 |
tttgtaactggcaattattgaagtatatgaaatacaagaatg |
42 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
781161 |
tttgtaactgacaattattgaagtatatgaaatacaagaatg |
781120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 56 - 175
Target Start/End: Complemental strand, 26305274 - 26305153
Alignment:
| Q |
56 |
cccatatctgatactcattatgtcctcaaaggatcacaaatccacactttcccttt-ggtatgtactttaagatgatcactactatcccattttta-tta |
153 |
Q |
| |
|
||||| ||||||| | | || ||||||||||||||||||||||||||| |||||| ||||||||||||| || ||||||||||||||||||||| ||| |
|
|
| T |
26305274 |
cccatttctgataatgaatacgtcctcaaaggatcacaaatccacactaccccttttggtatgtactttatcataatcactactatcccatttttattta |
26305175 |
T |
|
| Q |
154 |
ttcacattgatattgagtatgg |
175 |
Q |
| |
|
|||| ||| || |||||||||| |
|
|
| T |
26305174 |
ttcatattaatgttgagtatgg |
26305153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University