View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11037_low_1 (Length: 296)
Name: NF11037_low_1
Description: NF11037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11037_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 31674465 - 31674745
Alignment:
| Q |
1 |
ctcaaacttgattgatttgtatcaaaactaatcatatcatcatctcttcttgctccgggtggcaatcctcgtaagaggcaattagttacttagagtcaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31674465 |
ctcaaacttgattgatttgtatcaaaactaatcatatcatcatctcttcttgctccgggtggcaatcctcgtaagaggcaattagttacttggagtcaaa |
31674564 |
T |
 |
| Q |
101 |
aaagttggtaaatttacgagtcaaataagtagtactttttaaaatttccatagacaactcttatataattttttattggtacaaagtgtccattattaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31674565 |
aaagttggtaaatttacgagtcaaataagtagtactttttaaaattttcagagacaactcttatataattttttattggtacaaagtgtccattattaaa |
31674664 |
T |
 |
| Q |
201 |
agtcactatttgtctttctttagattgttgttgttgnnnnnnnnnnnnnncctttctttacatatttcagacgcttctttt |
281 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31674665 |
agtaactatttgtctttctttagattgttgttgtttttttttttttttttcctttctttacatatttcagacgcttctttt |
31674745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University