View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11037_low_2 (Length: 261)
Name: NF11037_low_2
Description: NF11037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11037_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 141 - 241
Target Start/End: Complemental strand, 4716363 - 4716262
Alignment:
| Q |
141 |
aacacctca-attccggcttgttaattacttccaggccgggtttacttatattttatgcccaaagcaatgcctaatcattaattgcagtttaaagataac |
239 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4716363 |
aacacctcatattacggcttgttaattacttccaggccgggtttacttaaattttatgctcaaagcaatgcctaatcattaattgcagtttaaagataac |
4716264 |
T |
 |
| Q |
240 |
gt |
241 |
Q |
| |
|
|| |
|
|
| T |
4716263 |
gt |
4716262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 4716503 - 4716429
Alignment:
| Q |
1 |
cctataaattctctctcatattcctaaacaaaaggcctctcatattgtatctgataaaatatattgtccatcttg |
75 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4716503 |
cctataaattatctctcagattcctaaacaaaaggcctctcatattgtatctgataaaatatattgtccatcttg |
4716429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University