View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11038_high_10 (Length: 289)
Name: NF11038_high_10
Description: NF11038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11038_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 20 - 277
Target Start/End: Complemental strand, 42163868 - 42163611
Alignment:
| Q |
20 |
tttgcttcattaagtcatttgttaatcatgtttaatgatttggagtctcttttttgacaggtgagagaactggaaacaaatcccctgttcaattctgggc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42163868 |
tttgcttcattaagtcatttgttaatcatgtttaatgatttggagtctcttttttgacaggtgagagaactggaaacaaatcccctgttcaattctgggc |
42163769 |
T |
|
| Q |
120 |
gtggatctgctttgacagcaaaaggaacagttgaaatggaggctagcatcatggatggtacaaagagaagatgtggtgctgtatctggtgttaccaccgt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42163768 |
gtggatctgctttgacagcaaaaggaacagttgaaatggaggctagcataatggatggtacaaagagaagatgtggtgctgtatctggtgttaccaccgt |
42163669 |
T |
|
| Q |
220 |
gaaaaaccctgtctcacttgctcgccttgtcatggaaaagtcccctcattcataccta |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42163668 |
gaaaaaccctgtctcacttgctcgccttgtcatggaaaagtcccctcattcataccta |
42163611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 78 - 198
Target Start/End: Complemental strand, 5480776 - 5480656
Alignment:
| Q |
78 |
aggtgagagaactggaaacaaatcccctgttcaattctgggcgtggatctgctttgacagcaaaaggaacagttgaaatggaggctagcatcatggatgg |
177 |
Q |
| |
|
||||||| ||| ||||||| |||| || |||||||| || ||||||||||| |||| | ||||||||| || ||||||||||||||||| |||||||| |
|
|
| T |
5480776 |
aggtgagggaattggaaacggatccactattcaattcgggtcgtggatctgccctgacggaaaaaggaacggtggaaatggaggctagcataatggatgg |
5480677 |
T |
|
| Q |
178 |
tacaaagagaagatgtggtgc |
198 |
Q |
| |
|
|||| ||| |||| ||||| |
|
|
| T |
5480676 |
accaaaaagacgatgcggtgc |
5480656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 114; Significance: 7e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 107 - 276
Target Start/End: Original strand, 47170573 - 47170742
Alignment:
| Q |
107 |
ttcaattctgggcgtggatctgctttgacagcaaaaggaacagttgaaatggaggctagcatcatggatggtacaaagagaagatgtggtgctgtatctg |
206 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||| || |||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47170573 |
ttcaattctggccgtggatctgctctgacagcaaaaggaacggtggaaatggaggctagtatcatggatggtaccaagagaagatgtggtgctgtatctg |
47170672 |
T |
|
| Q |
207 |
gtgttaccaccgtgaaaaaccctgtctcacttgctcgccttgtcatggaaaagtcccctcattcatacct |
276 |
Q |
| |
|
||||| ||||||||||||| || |||| |||||||| |||||||||||||| ||||||||||| ||||| |
|
|
| T |
47170673 |
gtgtttccaccgtgaaaaatccaatctctcttgctcgtcttgtcatggaaaaatcccctcattcctacct |
47170742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University