View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11038_high_13 (Length: 250)
Name: NF11038_high_13
Description: NF11038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11038_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 27 - 242
Target Start/End: Original strand, 28726700 - 28726915
Alignment:
| Q |
27 |
agtgaatagttggatcaaggcaccagtcaagcacaatactttatacaatttctcattcccaacaccttattaactccaaagaataattgcaaattacttt |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28726700 |
agtgaatagttggatcaaggcaccagtcaagcacaatactttatacaatttcttattcccaacaccttattaactccaaagaataattgcaaattacttt |
28726799 |
T |
|
| Q |
127 |
gttcttattgtggacatatagcataaagtactgagaagcaaaaatcattgaagttatcacagtttcttacttaggtacatggtgagttgctactaccaac |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28726800 |
gttcttattgtggacatatagcataaagtactgagaagcaaaaatcattgaagttatcacagtttctcacttaggtacatggtgagttgctactaccaac |
28726899 |
T |
|
| Q |
227 |
catatatgtctctgct |
242 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
28726900 |
catatatgtctctgct |
28726915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University