View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11038_high_7 (Length: 346)
Name: NF11038_high_7
Description: NF11038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11038_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 87 - 332
Target Start/End: Original strand, 32273016 - 32273255
Alignment:
| Q |
87 |
ctcgttgtacttgtttctgtttctgagggaacaaggaaataggaatgagtctcgaagcaacatgcggatctatttactataataatgaaaaacaatgcta |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32273016 |
ctcgttgtacttgtttctgtttctgagggaacaaggaaataggaatgagtctcgaagcaacatgcggatctatttactataataatgaaaaacaatgcta |
32273115 |
T |
|
| Q |
187 |
aatttgatgcaatgtcgtaaaacannnnnnnaac--nnnnnnnnnngtcataaaacaattaatagtattatcaaccctaacaattaatattaccatatgg |
284 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32273116 |
aatttgatgcaatgtcgtaaaacatttttttaacaaaaaaaaaaaagtcataaaacaattaatagtattatcaaccctaacaatta--------atatgg |
32273207 |
T |
|
| Q |
285 |
atgggcacacaattcaaagttggtcttgcccttatagacactctcctc |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32273208 |
atgggcacacaattcaaagttggtcttgcccttatagacactctcctc |
32273255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University