View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11038_high_9 (Length: 299)
Name: NF11038_high_9
Description: NF11038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11038_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 2 - 126
Target Start/End: Original strand, 37434605 - 37434729
Alignment:
| Q |
2 |
atggatgccttggatagcctttgatacaagcggagggagctttctgttaaacaataggactatgatgtgtttcagtgtactgcttggatttctttttata |
101 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37434605 |
atggatgccttggatagcctttgttacaagcggagggagctttctgttaaacaataggactatgatatgtttcagtgtactgcttggatttctttttata |
37434704 |
T |
|
| Q |
102 |
agcatttgactgtggatatcaagaa |
126 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
37434705 |
agcatttgactgtggatatcaagaa |
37434729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 189 - 279
Target Start/End: Original strand, 37434797 - 37434886
Alignment:
| Q |
189 |
aatattttagtgaaagggttagagtaaattgctgcttgggatgtttagggggtttatatcacaccctctgaaatacgaccttttttctctg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37434797 |
aatattttagtgaaagggttagagtaaattgctgcttgggatgttta-ggggtttatatcacaccctctgaaatacgaccttttttctctg |
37434886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 24 - 98
Target Start/End: Original strand, 581026 - 581100
Alignment:
| Q |
24 |
gatacaagcggagggagctttctgttaaacaataggactatgatgtgtttcagtgtactgcttggatttcttttt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| | ||||| || | ||||||||||||||||||||||||| |
|
|
| T |
581026 |
gatacaagcggagggagctttctgttaatcaatagggccatgatatgctccagtgtactgcttggatttcttttt |
581100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 24 - 98
Target Start/End: Complemental strand, 591401 - 591327
Alignment:
| Q |
24 |
gatacaagcggagggagctttctgttaaacaataggactatgatgtgtttcagtgtactgcttggatttcttttt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| | ||||| || | ||||||||||||||||||||||||| |
|
|
| T |
591401 |
gatacaagcggagggagctttctgttaatcaatagggccatgatatgctccagtgtactgcttggatttcttttt |
591327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University