View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11039_high_22 (Length: 262)
Name: NF11039_high_22
Description: NF11039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11039_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 17 - 155
Target Start/End: Complemental strand, 38842561 - 38842423
Alignment:
| Q |
17 |
attttttgtatcactgccacataagcatcgcttttaaggaataatatataataaatcttggatggataacttacttgattgagggtttaaataagttaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38842561 |
attttttgtatcactgccacataagcatcgcttttaaggaataatatataataaatcttggatggataacttacttgattgagggtttaaataagttaaa |
38842462 |
T |
 |
| Q |
117 |
ggttgagggtgtaaatcctgacaaagtgaaaaactgtta |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38842461 |
ggttgagggtgtaaatcctgacaaagtgaaaaactgtta |
38842423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 191
Target Start/End: Complemental strand, 38842163 - 38842126
Alignment:
| Q |
154 |
taagataacaattaaattaacctactaatatttgtcag |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38842163 |
taagataacaattaaattaacctactaatatttgtcag |
38842126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University