View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11039_high_34 (Length: 210)
Name: NF11039_high_34
Description: NF11039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11039_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 3903071 - 3902981
Alignment:
| Q |
1 |
acaacctacatcttgaaatatttgtggagacttgcttttttggcctcccaaaaatactaa-attgttccgttcataactatcgaacgacaa |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3903071 |
acaacctacatcttgaaatatttgtggagacttgcttttttggcctcccaaaaatactaatattgttccgttcataactatcgaacgacaa |
3902981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 138 - 194
Target Start/End: Complemental strand, 3902964 - 3902908
Alignment:
| Q |
138 |
ccagcataactagaaaaacaaagctcatatttgtgagcttttgtccatctatggtct |
194 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3902964 |
ccagcataactagaaaaacacagctcatatttgtgagcttttgttcatctatggtct |
3902908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University