View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11039_low_15 (Length: 354)
Name: NF11039_low_15
Description: NF11039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11039_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 16 - 351
Target Start/End: Original strand, 4573950 - 4574285
Alignment:
| Q |
16 |
cactttttcggtgcgacccaccactgtgccctatgactaaccgcatcagaatacgccagcgagtatgacaaccatttcgaagtcgcaacccaccacttgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| ||||| |||||||||||||||||| | ||||||||||||||| |
|
|
| T |
4573950 |
cactttttcggtgcgacccaccactgtgccctatgactaaccgcctcagaatatgcccgcgagcatgacaaccatttcgaagccacaacccaccacttgg |
4574049 |
T |
|
| Q |
116 |
cacaccatgcatcactactttcttttcgagtgtaccgacacgccttcaccaaatccgcatgtaatagcacgtattagtggtgatcaatcaggtagtgact |
215 |
Q |
| |
|
||||||| || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
4574050 |
cacaccacgcgtcactactttcttttcgagtgtacagacacgccttcaccaaatccgcatgtaatagcgtgtattagtggtgatcaatcaggtggtgact |
4574149 |
T |
|
| Q |
216 |
cttttccaacatgtggagtggatcatattagtggtgacttttatttctacagacgacgttcaatccaatggtggctcttttctccaaggtgacgctcttt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
4574150 |
cttttccaacatgtggagtggatcatattagtggtgacttttatttctacagacaacgttcaatccaatggtggcttttttctccaaagtgacgctcttt |
4574249 |
T |
|
| Q |
316 |
ccaacgggtgaatcactaatcgcaatttctcttctt |
351 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4574250 |
cccacgggtgaatcactaatcgcaatttctcttctt |
4574285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University