View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11039_low_33 (Length: 237)
Name: NF11039_low_33
Description: NF11039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11039_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 14 - 234
Target Start/End: Original strand, 37118577 - 37118792
Alignment:
| Q |
14 |
gattgcaaaaggttgatcataaaagataaatcttgaaaaagctaagtcatgaacttgaatctaggtagnnnnnnnnntctcttctacgaagagttataag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37118577 |
gattgcaaaaggttgatcataaaagataaatcttgaaaaag-----tcatgaacttgaatctaggtagaaaaaaaaatctcttctacgaagagttataag |
37118671 |
T |
 |
| Q |
114 |
agcatgtgtacattaatcaagttctctttagtacacttgcaatgatacaagatttattgtaatattctctagtctgagagtaaaagaagcaatctccctc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37118672 |
agcatgtgtacattaatcaagttctcttcagtacacttgcaatgatacaagatttattgtaatattctctagtctcagagtaaaagaagcaatctccctc |
37118771 |
T |
 |
| Q |
214 |
tcacttatttcatctcactcg |
234 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
37118772 |
tcacttatttcatatcactcg |
37118792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University