View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11039_low_35 (Length: 225)
Name: NF11039_low_35
Description: NF11039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11039_low_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 15 - 211
Target Start/End: Original strand, 38595731 - 38595927
Alignment:
| Q |
15 |
gaagaatcaactatgcatctataggaggagactttgggtctttttgttttagaatcacctctatgcgtcatttttctcttctttttatctaaagaagtgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38595731 |
gaagaatcaactatgcatctataggaggagactttgggtctttttgttttagaatcacatctatgcgtcatttttctcttctttttatctaaagaagtgt |
38595830 |
T |
|
| Q |
115 |
tattcacacatattaggatctgtttttgtttgcgaattacttgtataagtgcggcatagtttggttttcgcatttttgtgcaatgtagttggatttt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38595831 |
tattcacacatattaggatctgtttttgtttgcgaattccttgtataagtgcggcataatttggttttcgcatttttgtgcgatgtagttggatttt |
38595927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University