View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11039_low_37 (Length: 215)
Name: NF11039_low_37
Description: NF11039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11039_low_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 15 - 199
Target Start/End: Complemental strand, 32088058 - 32087874
Alignment:
| Q |
15 |
tgaatatataggcggtgttgatgatttgaagaagatttatgatagcggtgagttgcaggagatgattgaacggttaccgaaaactttaccaaattcatgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32088058 |
tgaatatataggcggtgttgatgatttgaagaagatttatgatagcggtgagttgcaggagatgattgaacggttaccgaaaactttaccaaattcatgt |
32087959 |
T |
|
| Q |
115 |
gatttttgtggaggaatgagatttgtggtgtgtgatgaatgctatggaagtcatagggtttttgttgagaagaatgggtttagga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32087958 |
gatttttgtggaggaatgagatttgtggtgtgtgatgaatgctatggaagtcatagggtttttgttgagaagaatgggtttagga |
32087874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University