View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11040_high_29 (Length: 297)
Name: NF11040_high_29
Description: NF11040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11040_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 50 - 287
Target Start/End: Original strand, 28748095 - 28748331
Alignment:
| Q |
50 |
tatttttaaccgtccatccactctgaagttgagaattaatgcctcatatgaatgttttgtttccactcaatgacaaccacactacttaagcacacgccta |
149 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28748095 |
tatttttaaccgtccatccactctaaagttgagaattaatgcctcatatgaatgttttatttccactcaatgacaaccacactacttaagcacaagccta |
28748194 |
T |
 |
| Q |
150 |
tattgctggccaaattgataaaccacccctcacaatgatgatggcggttaagcannnnnnnnnatttctctcactttgccccctcaaacgcaaatatata |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28748195 |
tattgctggccaaattgataaaccacccctcacaatgatgatggcggttaagca-ttttttttatttctctcactttgccccctcaaacgcaaatatata |
28748293 |
T |
 |
| Q |
250 |
tctacccgctcctaatacctaaaaccttttggcctttg |
287 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28748294 |
tctaccctctcctaatacctaaaaccttttggcctttg |
28748331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 54 - 91
Target Start/End: Complemental strand, 38657357 - 38657320
Alignment:
| Q |
54 |
tttaaccgtccatccactctgaagttgagaattaatgc |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38657357 |
tttaaccgtccatccactctgaagttgagaattgatgc |
38657320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University