View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11040_high_32 (Length: 276)
Name: NF11040_high_32
Description: NF11040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11040_high_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 39078573 - 39078807
Alignment:
| Q |
1 |
aaccatgttaatattttatgcagcaacatatattgaggagtcttcctaaatatatatatagtgagctggaatatccatcaaaaacttgaatgctatttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39078573 |
aaccatgttaatattttatgcagcaacatatattgaggagtcttcctaaatatatatatagtgagctggaatatccatcaaaaacttgaatgctatttgc |
39078672 |
T |
 |
| Q |
101 |
attacacgcacgatatatattttttgtccaatctccatctccttcatttttgatgaaatgtgtccatcttctttagtccagatataaggatatatacaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39078673 |
attacacgcacgatatatattttttgtctaatctccatctccttcatttttgatgaaatgtgtccatcttctttagtccagatataaggatatatacaaa |
39078772 |
T |
 |
| Q |
201 |
atatgaaaatattagtatgctttcttttagaggga |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39078773 |
atatgaaaatattagtatgctttcttttagaggga |
39078807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University