View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11040_high_45 (Length: 213)
Name: NF11040_high_45
Description: NF11040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11040_high_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 39318198 - 39318043
Alignment:
| Q |
1 |
ataagctgaacattgtttgtcacaaggttcagttcaatggagtgattattaacatatatcagagtttgacatatggttagttacatataagttagtttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39318198 |
ataagctgaacattgtttgtcacaaggttcagttcaatggagtgattattaagatatatcagagtttgacatatggttagttacatataagttagtttta |
39318099 |
T |
 |
| Q |
101 |
gaggttacttgttttacaagtaaaccaaatagtcgaactttttattctaatacgtt |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39318098 |
gaggttacttgttttacaagtaaaccaaatagtcgaactttttattctactacgtt |
39318043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 151 - 207
Target Start/End: Complemental strand, 39316665 - 39316610
Alignment:
| Q |
151 |
tacgttgttatacaagtcattgtatgaatactattaaaataatgagattcatctcac |
207 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
39316665 |
tacgttgttatacaaatcattgtatgaatactatt-aaataatgagattcatttcac |
39316610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 70 - 123
Target Start/End: Complemental strand, 2610789 - 2610736
Alignment:
| Q |
70 |
catatggttagttacatataagttagttttagaggttacttgttttacaagtaa |
123 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2610789 |
catatggttagttggttagaagttagttttagaggttacttgttttccaagtaa |
2610736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University