View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11040_low_16 (Length: 424)
Name: NF11040_low_16
Description: NF11040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11040_low_16 |
 |  |
|
| [»] scaffold0380 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 2e-34; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 98 - 180
Target Start/End: Original strand, 28424311 - 28424393
Alignment:
| Q |
98 |
ggtggcgtttagcctgggaaagcaaatttgtttcccatgatgggaaactttgctctttacctgcagctggcagtcatgacctg |
180 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28424311 |
ggtggcgtttagcctgggaaagcaaagttgtttcccatgatgggaaactttgctttttacctgcagctggcagtcatgacctg |
28424393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 381 - 417
Target Start/End: Original strand, 28424593 - 28424629
Alignment:
| Q |
381 |
cttctctgcatctttcttattgttcctcttctctgct |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28424593 |
cttctctgcatctttcttattgttcctcttctctgct |
28424629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 235 - 301
Target Start/End: Original strand, 28424448 - 28424513
Alignment:
| Q |
235 |
gactttgcattctcaaagaacaaatgactcgtctgttgtcacaatcctaatccaattgcacactgtt |
301 |
Q |
| |
|
||||||||||||||| |||||||||||||| | || ||||| ||||||| ||||||||||| ||||| |
|
|
| T |
28424448 |
gactttgcattctcagagaacaaatgactcatttg-tgtcataatcctactccaattgcacgctgtt |
28424513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 5 - 97
Target Start/End: Original strand, 27316336 - 27316428
Alignment:
| Q |
5 |
ttatgcagaggaccatcattcaatccttatctaagaatattagttacttatggtaagtaaatacatcatcaaagataaataggattaaacata |
97 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27316336 |
ttatgcagaggatcatcattcaatcctaatctaagaatattagttacttatagtatgtaaatacatgatcaaagataaataggattaaacata |
27316428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 66; Significance: 5e-29; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 99 - 180
Target Start/End: Original strand, 23388234 - 23388315
Alignment:
| Q |
99 |
gtggcgtttagcctgggaaagcaaatttgtttcccatgatgggaaactttgctctttacctgcagctggcagtcatgacctg |
180 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||| ||||||| |
|
|
| T |
23388234 |
gtggcgtttagcctgggaaagcaaagttgtttcccatgatgggaaaatttgctttttacctgcagctggcagtcctgacctg |
23388315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 235 - 301
Target Start/End: Original strand, 23388367 - 23388433
Alignment:
| Q |
235 |
gactttgcattctcaaagaacaaatgactcgtctgttgtcacaatcctaatccaattgcacactgtt |
301 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23388367 |
gactttgcattctaagagaacaaatgactcgtctgttgtcacaatcctaatccaattgcacactgtt |
23388433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 371 - 417
Target Start/End: Original strand, 23388503 - 23388549
Alignment:
| Q |
371 |
ctcagccctccttctctgcatctttcttattgttcctcttctctgct |
417 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23388503 |
ctcagctcttcttctctgcatctttcttattgttcctcttccctgct |
23388549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.00000000001; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 381 - 417
Target Start/End: Original strand, 42840961 - 42840997
Alignment:
| Q |
381 |
cttctctgcatctttcttattgttcctcttctctgct |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42840961 |
cttctctgcatctttcttattgttcctcttctctgct |
42840997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 97 - 176
Target Start/End: Original strand, 42840750 - 42840830
Alignment:
| Q |
97 |
aggtggcgtttagcctgggaaagcaaatttgtttcc-catgatgggaaactttgctctttacctgcagctggcagtcatga |
176 |
Q |
| |
|
|||||||||| || | ||||||| ||| |||||| ||||||||||||||||||| ||||||| ||| |||||||||||| |
|
|
| T |
42840750 |
aggtggcgttaagtcggggaaagtaaagttgttttttcatgatgggaaactttgctttttacctccagttggcagtcatga |
42840830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 104 - 144
Target Start/End: Original strand, 40740666 - 40740706
Alignment:
| Q |
104 |
gtttagcctgggaaagcaaatttgtttcccatgatgggaaa |
144 |
Q |
| |
|
||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
40740666 |
gtttagcatgggaaaggaaaattgtttcccatgatgggaaa |
40740706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0380 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0380
Description:
Target: scaffold0380; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 105 - 144
Target Start/End: Complemental strand, 6151 - 6112
Alignment:
| Q |
105 |
tttagcctgggaaagcaaatttgtttcccatgatgggaaa |
144 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
6151 |
tttagcctgggaaaccaaagttgtttcccatgatgggaaa |
6112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 97 - 144
Target Start/End: Original strand, 10021004 - 10021051
Alignment:
| Q |
97 |
aggtggcgtttagcctgggaaagcaaatttgtttcccatgatgggaaa |
144 |
Q |
| |
|
||||| |||||||||||||||| |||| | |||||||||||||||||| |
|
|
| T |
10021004 |
aggtgccgtttagcctgggaaaacaaactagtttcccatgatgggaaa |
10021051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University