View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11040_low_19 (Length: 375)
Name: NF11040_low_19
Description: NF11040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11040_low_19 |
 |  |
|
| [»] scaffold1333 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1333 (Bit Score: 92; Significance: 1e-44; HSPs: 3)
Name: scaffold1333
Description:
Target: scaffold1333; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 18 - 117
Target Start/End: Complemental strand, 1325 - 1226
Alignment:
| Q |
18 |
cttcacatcaagaatagcagtatgcttttgagttgttctcaacctaaaataaatacaggctgaagttcaataagcgaattaaaatgcaaaatagtgatgg |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1325 |
cttcacatcaagaatagcattatgcttttgagttgttctcaacctaaaatgaatacaggctgaagttcaataagcgaattaaaatgcaaaatagtgatgg |
1226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1333; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 292 - 364
Target Start/End: Complemental strand, 1177 - 1105
Alignment:
| Q |
292 |
ataaatttattgtgtactcatcttccataatctcacaaaataaatatagtttctctttgagttccaagttcat |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1177 |
ataaatttattgtgtactcatcttccataatctcacaaaataaatatagttcctctttgagttccaagttcat |
1105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1333; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 150 - 190
Target Start/End: Complemental strand, 1214 - 1174
Alignment:
| Q |
150 |
atgcttcttaaaagacacagattaaaccatgtgtcagataa |
190 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1214 |
atgcttcttaaaagacagagattaaaccatgtgtcagataa |
1174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University