View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11040_low_27 (Length: 320)

Name: NF11040_low_27
Description: NF11040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11040_low_27
NF11040_low_27
[»] chr3 (2 HSPs)
chr3 (18-320)||(29332194-29332498)
chr3 (160-208)||(29303948-29303996)


Alignment Details
Target: chr3 (Bit Score: 286; Significance: 1e-160; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 18 - 320
Target Start/End: Complemental strand, 29332498 - 29332194
Alignment:
18 gataacaacgaaatatgcatcgaatgttgattggcggttacgtcatgcagctatgcttgccattgcttcaattgcagagaaaaacctcaacgggatggta 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
29332498 gataacaacgaaatatgcatcgaatgttgattggcggttacgtcatgcagctatgcttgccattgcttcaattgcagagaaaaacctcaacgagatggta 29332399  T
118 cgtataattcgatatgatattcaatgagctttaaatccata--gtgttttcttgatcatgcattaccttgtagaaagagcaatcatgtcatgtaaattca 215  Q
     ||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29332398 tgtataattcgatatgatattcaatgagctttaaatccataaagtgttttcttgatcatgcattaccttgtagaaagagcaatcatgtcatgtaaattca 29332299  T
216 atagatacttcaacagattctgatgggacacttcaaagttttgcatgatttctgtgtcttctattttgtacattgttcagagaagcgtgtttttgtttct 315  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29332298 atagatacttcaacagattctgatgggacacttcaaagttttgcatgatttctgtgtcttctattttgtacattgttcagagaagcgtgtttttgtttct 29332199  T
316 aagcc 320  Q
    |||||    
29332198 aagcc 29332194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 29303996 - 29303948
Alignment:
160 tgttttcttgatcatgcattaccttgtagaaagagcaatcatgtcatgt 208  Q
    |||||| | ||| ||||||||||||||||||| ||||||||||||||||    
29303996 tgttttttcgatgatgcattaccttgtagaaaaagcaatcatgtcatgt 29303948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University