View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11040_low_27 (Length: 320)
Name: NF11040_low_27
Description: NF11040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11040_low_27 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 286; Significance: 1e-160; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 18 - 320
Target Start/End: Complemental strand, 29332498 - 29332194
Alignment:
| Q |
18 |
gataacaacgaaatatgcatcgaatgttgattggcggttacgtcatgcagctatgcttgccattgcttcaattgcagagaaaaacctcaacgggatggta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29332498 |
gataacaacgaaatatgcatcgaatgttgattggcggttacgtcatgcagctatgcttgccattgcttcaattgcagagaaaaacctcaacgagatggta |
29332399 |
T |
 |
| Q |
118 |
cgtataattcgatatgatattcaatgagctttaaatccata--gtgttttcttgatcatgcattaccttgtagaaagagcaatcatgtcatgtaaattca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29332398 |
tgtataattcgatatgatattcaatgagctttaaatccataaagtgttttcttgatcatgcattaccttgtagaaagagcaatcatgtcatgtaaattca |
29332299 |
T |
 |
| Q |
216 |
atagatacttcaacagattctgatgggacacttcaaagttttgcatgatttctgtgtcttctattttgtacattgttcagagaagcgtgtttttgtttct |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29332298 |
atagatacttcaacagattctgatgggacacttcaaagttttgcatgatttctgtgtcttctattttgtacattgttcagagaagcgtgtttttgtttct |
29332199 |
T |
 |
| Q |
316 |
aagcc |
320 |
Q |
| |
|
||||| |
|
|
| T |
29332198 |
aagcc |
29332194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 29303996 - 29303948
Alignment:
| Q |
160 |
tgttttcttgatcatgcattaccttgtagaaagagcaatcatgtcatgt |
208 |
Q |
| |
|
|||||| | ||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29303996 |
tgttttttcgatgatgcattaccttgtagaaaaagcaatcatgtcatgt |
29303948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University