View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11040_low_38 (Length: 253)
Name: NF11040_low_38
Description: NF11040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11040_low_38 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 8 - 253
Target Start/End: Complemental strand, 44948260 - 44948015
Alignment:
| Q |
8 |
agaagcaaaggtgaaatcagaagaggatgcaaatatagtatgaagcgtcttccaagcaagattttcattggatttaatgattcttaagccaaaagcaact |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44948260 |
agaagccaaggtgaaatcagaagaggatgcaaatatagtatgaagcgtcttccaagcaagattttcattggatttaatgattcttaagccaaaagcaact |
44948161 |
T |
|
| Q |
108 |
aaaaagttagaaaatacacactatattgatgctaagtatagtctatgaaaatggattgtatgtagttatgcaatcagggagctgtctgatcttacattcc |
207 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44948160 |
agaaagttagaaaatacacactatattgatgctaagtatagtctatgaaaatggattgtatgtagttatgcaatcagggagctgtctgatcttacattcc |
44948061 |
T |
|
| Q |
208 |
aattgtgttttagattgtttaatcaaagtcatgacacaagtcttct |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44948060 |
aattgtgttttagattgtttaatcaaagtcatgacacaagtcttct |
44948015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 8 - 81
Target Start/End: Original strand, 11450551 - 11450624
Alignment:
| Q |
8 |
agaagcaaaggtgaaatcagaagaggatgcaaatatagtatgaagcgtcttccaagcaagattttcattggatt |
81 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||| ||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
11450551 |
agaagctaaggtgaaatcagaggaggatgcaaagatagtatgaaggatcttccaggcaagattttcattggatt |
11450624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 133 - 188
Target Start/End: Original strand, 11450640 - 11450696
Alignment:
| Q |
133 |
ttgatgctaagtatagt-ctatgaaaatggattgtatgtagttatgcaatcagggag |
188 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
11450640 |
ttgatgctaagtgtagtactatgaaaatggattatatgtagttatgcaatcaaggag |
11450696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 229
Target Start/End: Original strand, 11450707 - 11450750
Alignment:
| Q |
186 |
gagctgtctgatcttacattccaattgtgttttagattgtttaa |
229 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||| ||||| |
|
|
| T |
11450707 |
gagctgtctgatcttacattccgactgtgttttagattatttaa |
11450750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University