View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11040_low_42 (Length: 242)
Name: NF11040_low_42
Description: NF11040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11040_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 33 - 227
Target Start/End: Original strand, 33994413 - 33994610
Alignment:
| Q |
33 |
tcccatagtgaccggtactttatttttgcatgcaaagctatatttgaaatgtcaagccttttctattttagtttctaatcannnnnnngtaatcgaatga |
132 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33994413 |
tcccatagtgactggtactttattta-gcatgcaaagctatatttggaatgtcaagccttttctattttagtttctaatcatttttttgtaatcgaatga |
33994511 |
T |
 |
| Q |
133 |
tgtagtcactgtattatactc----cggtcacatactatatcattttctctaagtgtaaagataacaactaaatgaaatattagttactactttggact |
227 |
Q |
| |
|
|||||||||| ||| ||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33994512 |
tgtagtcactatataatatccttttcggtcacatactatatcattttctctaagtgtaaagataacaactaaatgaaatattagttactactttggact |
33994610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 152 - 201
Target Start/End: Original strand, 10592727 - 10592776
Alignment:
| Q |
152 |
tccggtcacatactatatcattttctctaagtgtaaagataacaactaaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10592727 |
tccggtcacatactatatcattttctctaagtgtaaagataacaactaaa |
10592776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University