View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11040_low_46 (Length: 222)
Name: NF11040_low_46
Description: NF11040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11040_low_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 29932498 - 29932701
Alignment:
| Q |
1 |
agagaacatatcatatgagacattatcaaaatacaatactgctagattaacattgaatttcattgatctaatgcttaaatcaaaagtttttatcgaatag |
100 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29932498 |
agagaacatatagtatgagacattatcgaaatacaatactgttagatcaacattgaatttcattgatctaatgcttaaatcaaaagtttttatcgaatag |
29932597 |
T |
|
| Q |
101 |
ctcaactcgataaatttgaataaaattactcgatggtctattaaataaattcaaatcaaaatataatataaataagtctatctacaaattttaggttcat |
200 |
Q |
| |
|
|||| ||||| ||||||||||||||||||| |||| |||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29932598 |
ctcagctcgacaaatttgaataaaattacttgatgctctattgaataaattcaaatcaacatataatataaataagtctatctacaaattttaggttcat |
29932697 |
T |
|
| Q |
201 |
aaga |
204 |
Q |
| |
|
|||| |
|
|
| T |
29932698 |
aaga |
29932701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University