View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11041_high_3 (Length: 328)
Name: NF11041_high_3
Description: NF11041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11041_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 318
Target Start/End: Complemental strand, 43339730 - 43339413
Alignment:
| Q |
1 |
cgaagctgctgccacaataatcttcatcatattcagcatcacggaacaaatttgacagcaccaaatagaannnnnnnncaccaagaaccctgctccttcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43339730 |
cgaagctgctgccacaataatcttcatcatattcagcatcacggaacaaatttgacagcaccaaatagaattttttttcaccaagaaccctgctccttcg |
43339631 |
T |
 |
| Q |
101 |
tcgggcagccagcagaaggtatcagaaacagatggtcgcggctgcacctgcagaatttcctactgcaaaacagatggtccggttgcaaatttttggacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43339630 |
tcgggcagccagcagaaggtatcagaaacagatggtcgcggctgcacctgcagaatttcctactgcaaaacagatggtccggttgcaaatttttggacca |
43339531 |
T |
 |
| Q |
201 |
attccatctccaaatccacatattatctcaccaacatcccatgtcggacaccttaacatctctgttagaaaccgcactgaataaatgagggaatcacaca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43339530 |
attccatctccaaatccacatattatctcaccaacatcccatgtcggacaccttaacatctctgttagaaaccgcactgaataaatgagggaatcacaca |
43339431 |
T |
 |
| Q |
301 |
cagaatggttgttctctg |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
43339430 |
cagaatggttgttctctg |
43339413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University