View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11041_low_11 (Length: 219)
Name: NF11041_low_11
Description: NF11041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11041_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 14 - 204
Target Start/End: Complemental strand, 2653679 - 2653489
Alignment:
| Q |
14 |
agacaaataaatgatgttgttcataaaaagtttcgcggcgttcgacaacgacgatgggggagatttgctgctgagattcgcgatccaaggcttggtagga |
113 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2653679 |
agacaaataaatgatgttgttcatcaaaagtttcgcggcgttcgacgacgacgatgggggagatttgctgctgagattcgtgatccaaggcttggtagga |
2653580 |
T |
|
| Q |
114 |
gaaggtggttagggacatatgatactgctgaagaagctgctttggtttatgatagagctgcaattgattgtagaggtgctgatgctgttac |
204 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2653579 |
gaaggtggttagggacatatgataccgctgaagaagctgctttggtttatgatagagctgcaattgattgtagaggtgctgatgctgttac |
2653489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 119 - 174
Target Start/End: Complemental strand, 6507711 - 6507656
Alignment:
| Q |
119 |
tggttagggacatatgatactgctgaagaagctgctttggtttatgatagagctgc |
174 |
Q |
| |
|
|||||||| |||| |||||||||| ||||||||||||| | ||||||||||||||| |
|
|
| T |
6507711 |
tggttaggaacatttgatactgctcaagaagctgcttttgcttatgatagagctgc |
6507656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 137 - 174
Target Start/End: Original strand, 25986021 - 25986058
Alignment:
| Q |
137 |
actgctgaagaagctgctttggtttatgatagagctgc |
174 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25986021 |
actgctgaagaagctgctttggcttatgatagagctgc |
25986058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University