View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11043_high_24 (Length: 203)
Name: NF11043_high_24
Description: NF11043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11043_high_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 19 - 181
Target Start/End: Complemental strand, 11379701 - 11379533
Alignment:
| Q |
19 |
aaggccgacggttgttctctggtgggtggtg------gtggacgcagaaccggtgggttcgtgtgtgttgcgtgcaacagtcaatttgggaaagaaaagg |
112 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
11379701 |
aaggccgacggctgttctctggtgggtggtgctggtggtggacgcagaaacggtgggttcgtgtgtgttgcgtgcagcagttgatttgggaaagaaaagg |
11379602 |
T |
 |
| Q |
113 |
gaaaaggaaaatgtgtgtgttctgttgttgagtgagtgctgagaaaacaaaaatatttgtggctattgc |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11379601 |
gaaaaggaaaatgtgtgtgttctgttgttgagtgagtgctgagaaaacaaaaatatttgtggctattgc |
11379533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University