View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11043_low_22 (Length: 232)
Name: NF11043_low_22
Description: NF11043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11043_low_22 |
 | |
|
| [»] scaffold1084 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 60 - 169
Target Start/End: Original strand, 11379738 - 11379847
Alignment:
| Q |
60 |
ttattctaggtctgttttgattttgaactcaaattactttatagtaacaagtgagcaattgaaccaggatattgaaattgaattaagatagtgagagtac |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11379738 |
ttattctaggtctgttttgattttgaactcaaattacttgatagtaacaagtgagcaattgaaccaggatattgaaattgaattaagatagtgagagtac |
11379837 |
T |
|
| Q |
160 |
tagtgattgc |
169 |
Q |
| |
|
|||||||||| |
|
|
| T |
11379838 |
tagtgattgc |
11379847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 160 - 217
Target Start/End: Original strand, 11379984 - 11380041
Alignment:
| Q |
160 |
tagtgattgcagtagcattgttaaatgatcgtcttgtaacatatattgaaagtgatgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11379984 |
tagtgattgcagtagcattgttaaatgatcgtcttgtaacatatattgaaagtgatgt |
11380041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1084 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold1084
Description:
Target: scaffold1084; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 116 - 173
Target Start/End: Complemental strand, 360 - 297
Alignment:
| Q |
116 |
aattgaaccaggatattgaaattgaa------ttaagatagtgagagtactagtgattgcagta |
173 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
360 |
aattgaatcaggatattgaaattgaaaccgaattaagatagtgagagtagtagtgattgcagta |
297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 163
Target Start/End: Complemental strand, 45298854 - 45298821
Alignment:
| Q |
130 |
attgaaattgaattaagatagtgagagtactagt |
163 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
45298854 |
attgaaattgaattaagatagtgagagtagtagt |
45298821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University