View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11044_high_4 (Length: 231)
Name: NF11044_high_4
Description: NF11044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11044_high_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 213
Target Start/End: Complemental strand, 26194660 - 26194463
Alignment:
| Q |
16 |
atgaacataagaagaagaaaatgggtaagtgtatatgagacctattcatctttcattatatcctaatcatggtcgcgacacgattcttgctattgcggag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26194660 |
atgaacataagaagaagaaaatgggtaagtgtatatgagacctattcatctttcattatatcctaatcatggtcgcgacacgattcttgctattgcggag |
26194561 |
T |
 |
| Q |
116 |
aattgtagtcaaatacaattattgcaacctcaatcaaagccgctgggacgtcaaaatcttgacgtcgcagcgcagattgaggttgcatatatgttttt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26194560 |
aattgtagtcaaatacaattattgcaacctcaatcaaagccgctgcgacgtcaaaatcttgatgtcgcagcgcagattgatgttgcatatatgttttt |
26194463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 26194405 - 26194360
Alignment:
| Q |
168 |
aaaatcttgacgtcgcagcgcagattgaggttgcatatatgttttt |
213 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26194405 |
aaaatcctgacgtcgcggcgcagattgaggttgcatatatgttttt |
26194360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University