View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11044_high_6 (Length: 220)
Name: NF11044_high_6
Description: NF11044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11044_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 17 - 117
Target Start/End: Original strand, 6694280 - 6694381
Alignment:
| Q |
17 |
gagatgaaaccaaaaaagttgattgggtaacatggtaaaaattctcaagtttcgtggaatttggaaataagaaaactgagatgggt-tttaagcataaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6694280 |
gagatgaaaccaaaaaagttgattgggtaacatggtaaaagttctcaactttcgtggaatttggaaataagaaaactgagatgggtctttaagcataaca |
6694379 |
T |
|
| Q |
116 |
at |
117 |
Q |
| |
|
|| |
|
|
| T |
6694380 |
at |
6694381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University