View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11045_high_16 (Length: 242)

Name: NF11045_high_16
Description: NF11045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11045_high_16
NF11045_high_16
[»] chr2 (1 HSPs)
chr2 (1-107)||(34841917-34842023)


Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 34842023 - 34841917
Alignment:
1 ccagctgtatataagaaattcactttgagggagtatagacaacagactctgaacgatgtcaaagaaacaggagataaagtggggctctctagatttgttc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
34842023 ccagctgtatataagaaattcactttgagggagtatagacaacagacactgaacgatgtcaaagaaacaggagataaagtggggctctctagatttgttc 34841924  T
101 tttagaa 107  Q
    |||||||    
34841923 tttagaa 34841917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University