View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11045_high_18 (Length: 240)
Name: NF11045_high_18
Description: NF11045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11045_high_18 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 48417212 - 48416973
Alignment:
| Q |
1 |
cggagttaacttggaggacgcagcttttgtttatcatgaaagtatcaaagtgttttctactttcaggtgcaattttagaggaagcatcagatctttgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48417212 |
cggagttaacttggaggacgcagcttttgtttatcatgaaagtatcaaagtgttttctactttcaggtgcgattttagaggaagcatcagatctttgttg |
48417113 |
T |
 |
| Q |
101 |
agtttgtatgcatctcatttgccatctgctgtttgaaatgtttttacatcaaagcttggagacatttcaattaagcttccaatcttcatatgttaaaaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48417112 |
agtttgtatgcatctcatttgccatctgctgtttgaaatgtttttacatcaaagctttgagacatttcaattaagcttccaatcttcatatgttaaaaag |
48417013 |
T |
 |
| Q |
201 |
gaatttatttgattcatgacaaaagcagttgacatttgtt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48417012 |
gaatttatttgattcatgacaaaagcagttgacatttgtt |
48416973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University