View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11045_high_2 (Length: 533)
Name: NF11045_high_2
Description: NF11045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11045_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 492; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 492; E-Value: 0
Query Start/End: Original strand, 11 - 518
Target Start/End: Complemental strand, 3268679 - 3268172
Alignment:
| Q |
11 |
cacagaggatccatatagcactttgagttcatgggtttctggtggattcccatgtcaaggttacacaggtgtcttctgtaacatagaaggttttgtagaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3268679 |
cacagaggatccatatagcactttgagttcatgggtttctggtggagacccatgtcaaggttacacaggtgtcttctgtaacatagaaggttttgtagaa |
3268580 |
T |
 |
| Q |
111 |
agaattgtgctttggaacactagcttggtgggtgtgttgtcaccagcactctcagggttgaagaggttgaggatattgacattgtttgggaatcgatttt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3268579 |
agaattgtgctttggaacactagcttggtgggtgtgttgtcaccagcactctcagggttgaagaggttgaggatattgacattgtttgggaatcgatttt |
3268480 |
T |
 |
| Q |
211 |
cgggtaatattccagatgattatgctgatcttcactcattgtggaagattaatttcagctccaatgcgttatccggttcgatcccagatttcattggtga |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3268479 |
cgggtaatattccagatgattatgctgatcttcactcattgtggaagattaatttcagctccaatgcgttatccggttcgatcccagatttcatgggtga |
3268380 |
T |
 |
| Q |
311 |
tttgcctaatattcgttttctagatttatcaaagaatggtttcaatggggagataccttcagctttgtttaggtactgctataaaactaagtttgtttct |
410 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3268379 |
tttgcctaatattcgttttctagatttatcaaagaatggcttcaatggggagataccttcagctttgtttaggtactgctataaaactaagtttgtttct |
3268280 |
T |
 |
| Q |
411 |
ctttctcataacaatcttgtaggttcaattcctgtgtctttggtgaattgctctaaccttgaaggttttgatttttctttcaataatcttagcggtgttg |
510 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3268279 |
ctttctcataacaatcttgtaggttcaattcctgtgtctttggtgaattgctctaaccttgaaggttttgatttttctttcaataatcttagcggtgttg |
3268180 |
T |
 |
| Q |
511 |
tcccttct |
518 |
Q |
| |
|
|||||||| |
|
|
| T |
3268179 |
tcccttct |
3268172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University